Antisense Technology: General Methods, Methods of Delivery, by Abelson J.N., Simon M.I., Phillips I.M. (eds.)

By Abelson J.N., Simon M.I., Phillips I.M. (eds.)

Antisense expertise is the facility to govern gene expression inside mammalian cells delivering robust experimental ways for the research of gene functionality and gene rules. for instance, tools that inhibit gene expression let experiences which probe the traditional functionality of a selected product inside of a telephone. Such method can be utilized in lots of disciplines corresponding to pharmacology, oncology, genetics, cellphone biology, developmental biology, molecular biology, biochemistry, and neurosciences. This quantity might be a really vital device in biomedical-oriented learn. The severely acclaimed laboratory ordinary for greater than 40 years, equipment in Enzymology is likely one of the so much hugely revered courses within the box of biochemistry. due to the fact 1955, every one quantity has been eagerly awaited, often consulted, and praised by way of researchers and reviewers alike. Now with greater than three hundred volumes (all of them nonetheless in print), the sequence includes a lot fabric nonetheless correct this present day - really a vital e-book for researchers in all fields of lifestyles sciences.

Show description

Read Online or Download Antisense Technology: General Methods, Methods of Delivery, and RNA Studies Part A PDF

Best biology books

Bacterial Toxins: Methods and Protocols (Methods in Molecular Biology Vol 145)

Skilled researchers describe in step by step aspect robust tools for the research of bacterial exo- and endotoxins. those state of the art recommendations variety from purification and detection tools to equipment of conformational research, and contain using phage antibody libraries and strategies of structural and useful analyses of endotoxins.

The behavior and sensory biology of elasmobranch fishes: an anthology in memory of Donald Richard Nelson

The elasmobranch fishes contain the residing sharks, skates and rays which are very important individuals of approximately all marine ecosystems. Their huge dimension, secretive habit, and wide-ranging behavior cause them to tricky to watch within the box or to take care of in captivity. accordingly, little is understood approximately their common habit and the way it truly is mediated by means of their sensory structures.

Plant Evolutionary Biology

There are nonetheless heroes in technological know-how. they're famous as the matters and difficulties they selected to review grew to become the problems and difficulties of a massive box of analysis. also they are well-known simply because their insights and ideas are those which are demonstrated and evaluated whilst new principles and applied sciences turn into to be had.

Advances in Fetal and Neonatal Physiology: Proceedings of the Center for Perinatal Biology 40th Anniversary Symposium

To have fun the heart for Perinatal Biology’s fortieth Anniversary, an illustrious workforce accumulated at Loma Linda collage in February 2013. That accumulating of specialists and this quantity of the court cases are a tribute to the founding father of the guts, Lawrence D. Longo, M. D. those chapters current contributions from people who in a roundabout way or one other have been prompted by means of Dr.

Additional resources for Antisense Technology: General Methods, Methods of Delivery, and RNA Studies Part A

Example text

12M. I. Phillips and R. Gyurko, Reg. Pep. 59, 131 (1995). 13 C. Helene, Anticancer Drug Res. 6, 569 (1991). 14 R. A. Stull, L. A. Taylor, and F. C. Szoka, Nucleic Acids. Res. 20, 3501 (1992). 15'16These differences may be related to the predicted secondary structure of the target mRNA. 17-19 The folding of mRNA influences target sequence availability. RNA double helices, which are responsible for the secondary structure of the mRNA, incorporate a weaker G - U base pairing next to A - U and G - C and are generally short and rarely perfect.

Exp. Ther. 281, 810 (1997). 158K. G. Cornish, P. Iversen, L. Smith, M. Arneson, and E. Bayever, Pharrnacol. Comm. 3, 239 (1993). 159W. M. Galbraith, W. C. Hobson, P. C. Giclas, P. J. Schechter, and S. Agrawal, Antisense Res. Dev. 4, 201 (1994). 1593p. Nicklin, unpublished observation. 16oS. P. Henry, W. Novotny, J. Leeds, C. Auletta, and D. J. Kornbrust, Antisense Nucleic Acid Drug Dev. 7, 503 (1997). 161j. M. Glover, J. M. Leeds, T. G. K. Mant, D. Amin, D. L. Kisner, J. E. Zuckerman, R. S. Geary, A.

Wahlestedt, TIPS 15, 42 (1994). 50 GENERAL METHODS [21 1 TCCTGGGGTGCTTCCCAGGCGCGGCCCAGTCCCGCCACACCCCCCGCCCC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1190 T C C T G G G G T G C T T C C C A G G C G C G G C C C A G T C C C G C C A C A C C C C C C G C G C C 51 C G G C C T C C G A A G C T C G G C A T G G G C G C G G G G G C G C T C G C C C T G G G C G C C T C IIIIIIIIIIII 50 II 1239 i00 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1240 C G G C C T C C G A A G . T C ~ G C A T G G G C G C G G G G G C G C T C G C C C T G G G C G C C T C i01 C G A A C C C T G C A A C C T G T C G T C G G C C G C G C C G C T G C C C G A C G G C G C G G C C A 1288 150 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1289 C G A A C C C T G C A A C C T G T C G T C G G C C G C G C C G C T G C C C G A C G G C G C G G C C A 151 C C G C G G C A C G A C T G C T G G T G C T C G C G T C G C C T C C C G C C T C G C T G C T G C C T 1338 200 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1339 C C G C G G C A C G A C T G C T G G T G C T C G C G T C G C C T C C C G C C T C G C T G C T G C C T 201 C C A G C C A G C G A G G G C T C A G C G C C G C T G T C G C A G C A G T G G A C C G C G G G T A T 1388 250 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1389 C C A G C C A G C G A G G G C T C A G C G C C G C T G T C G C A G C A G T G G A C C G C G G G T A T 1438 FIG.

Download PDF sample

Rated 4.86 of 5 – based on 14 votes